[No authors listed]
The cyclic AMP (cAMP)/protein kinase A cascade plays a central role in cardiomyocyte proliferation and apoptosis. Here, we show that H(2)O(2) stimulates expression of the antiapoptotic myocardial ischemic preconditioning up-regulated protein 1 (Mipu1) gene in H9c2 cardiomyocytes through a pathway involving the cAMP-response element binding protein (CREB). Stimulation of H9c2 cardiomyocytes with H(2)O(2) resulted in increased Mipu1 promoter activity. Analysis of the rat Mipu1 promoter revealed two potential cAMP-response elements, one of which (CRE-II, TGTGGATGTTGACGAGCTTGT) was shown, using mutagenesis and deletion analysis, to be functional. Subsequent studies established that H(2)O(2) increased phosphorylation of CREB serine 133 through a pathway involving activation. Phospho-CREB was demonstrated to bind to CRE-II of the Mipu1 promoter, and H(2)O(2) treatment resulted in increases in their interaction as assessed by ChIP. Furthermore, H(2)O(2)-mediated up-regulation of Mipu1 protein expression was abrogated by the suppression of CREB expression with small interfering RNA of CREB. It was demonstrated that the H(2)O(2)-induced up-regulation of Mipu1 in H9c2 cardiomyocytes was mediated by CREB activation.
KEYWORDS: {{ getKeywords(articleDetailText.words) }}
| Sample name | Organism | Experiment title | Sample type | Library instrument | Attributes | |||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| {{attr}} | ||||||||||||||||||||||||||||||||||||||||||||||||||||||
| {{ dataList.sampleTitle }} | {{ dataList.organism }} | {{ dataList.expermentTitle }} | {{ dataList.sampleType }} | {{ dataList.libraryInstrument }} | {{ showAttributeName(index,attr,dataList.attributes) }} | |||||||||||||||||||||||||||||||||||||||||||||||||
| {{ list.authorName }} {{ list.authorName }} |